Project:Blood typing

How genes code for blood group

Blood group is determined by the combination of A and B antigens in your red blood cells. A and B individuals have only their respective corresponding antigens, AB individuals have both, and O individuals have none.

The production of these antigens is determined by the "histo-blood group ABO system transferase" gene (1062 base pairs), which is part of the ABO gene locus. This gene codes for the expression of a glycosyltransferase enzyme which by acting on another antigen(H), produces A or B antigens. The A and B allelic forms of the gene code for different forms of glycosyltransferase which affect the H antigen in different ways. O alleles code for another protein that doesn't affect the H antigen, meaning no A or B antigens are expressed. O alleles have a deletion of G at 258, while B alleles have a single nucleotide polymorphism (SNP) from G to A at position 700.

Each person has two of these alleles, one from each parent. A and B are dominant, O is recessive, so the possible combinations are:

Alleles	Blood group
AA	A
AO	A
BB	B
BO	B
AB	AB
OO	O

In the UK the distribution of A, B, AB and O is 42%, 10%, 4% and 44%.

Process overview

1) Obtain two sequences of DNA through PCR, the first containing the deletion site at 258, and the second containing the SNP site at 700

2) Use restriction enzyme KpnI on the first fragment to cut the O alleles only, and use restriction enzyme AluI on the second fragment to cut the B alleles only. (KpnI's cutting site is GGTAC^C - in A and B alleles there is a G between the latter two Cs, hence they are not cut. AluI's cutting site is AG^CT - in A and O alleles the initial A is a G, hence only B alleles are cut.)

3) Do gel electrophoresis on the resulting fragments, hopefully resulting in distinguishable bands to show the 6 different alleles. We should then be able to determine an individual's blood type.

Process reality

Much of the necessary equipment we already have from the sex typing experiments. Of the new things, we need the restriction enzymes, and possible a new gel - see below.

All fragments in the papers are between 80 and 200 bp long. For this we would need a polyacrylamide gel (which we have decided against due to difficulty with handling) or a high quality agarose concentrated at 3%, which is a bit expensive, but not impossible. So we are currently looking into the possibility of doing the test using larger fragments. Our agarose at the moment is suitable for fragments > 500bp.

Design of larger fragments:

Using the ApE software, we have found a possible pair of primers to enable us to use longer fragments.

Primers for G deletion sequence:

Primer	Sequence	Length	GC%	Tm(°C)
P1 forward	17484 5' CCCGCAGGTCCAATGTTGAG 3' 17503			59
P1 reverse	18268 5' ATCTGACAGAGAAGTGACCACG 3' 18247			58

Product 784bp. With digestion with KpnI 243bp and 541bp

Primers for G to A SNP:

Primer	Sequence	Length	GC%	Tm(°C)
P2 forward	19125 5' GAGGTGGATTACCTGGTGTGC 3' 19145	21	57	59
P2 reverse	19473 5' GCACCTTGGTGGGTTTGTGG 3' 19454	20	60	60

Product: 347 bp Digestion with AluI : 96 bp and 251 bp

New equipment

Sigma aldrich have KpnI and AluI. I couldn't find them on NBS bio. A cheaper alternative is to try to get them from NEB (http://www.neb.uk.com/).

If we do need high quality agarose here is sigma's selection. NBSbio have agarose but no info on its purity.

Sources

Most of the procedure came from this paper. With some more here. For other papers and background see here.

Here is a sequence viewer for the ABO gene. Histo-blood group ABO system transferase starts at position 28 - so to find the deletion at 258 and the SNP at 700 you have to add 28 to the numbers on the viewer. Go from the 5' end.