927
edits
Project:Blood typing: Difference between revisions
From London Hackspace Wiki
→Process reality
Mycoplasma (talk | contribs) |
Mycoplasma (talk | contribs) |
||
| Line 46: | Line 46: | ||
All fragments in the papers are between 80 and 200 bp long. For this we would need a polyacrylamide gel (which we have decided against due to difficulty with handling) or a high quality agarose concentrated at 3%, which is a bit expensive, but not impossible. So we are currently looking into the possibility of doing the test using larger fragments. Our agarose at the moment is suitable for fragments > 500bp. | All fragments in the papers are between 80 and 200 bp long. For this we would need a polyacrylamide gel (which we have decided against due to difficulty with handling) or a high quality agarose concentrated at 3%, which is a bit expensive, but not impossible. So we are currently looking into the possibility of doing the test using larger fragments. Our agarose at the moment is suitable for fragments > 500bp. | ||
'''Design of larger fragments:''' | |||
Using the ApE software, we have found a possible pair of primers to enable us to use longer fragments. | |||
{|border="1" cellpadding="5" | |||
|- | |||
! scope="col" | Primer | |||
! scope="col" | 5'-->3' | |||
! scope="col" | Tm(°C) | |||
|- | |||
|P1 forward | |||
|17484 CCCGCAGGTCCAATGTTGAG 17503 | |||
|59 | |||
|- | |||
|P2 reverse | |||
|18268 ATCTGACAGAGAAGTGACCACG 18247 | |||
|58 | |||
|} | |||
== New equipment == | == New equipment == | ||
