927
edits
Mycoplasma (talk | contribs) |
Mycoplasma (talk | contribs) |
||
| Line 50: | Line 50: | ||
Using the ApE software, we have found a possible pair of primers to enable us to use longer fragments. | Using the ApE software, we have found a possible pair of primers to enable us to use longer fragments. | ||
Primers for G deletion sequence: | |||
{|border="1" cellpadding="5" | |||
|- | |||
! scope="col" | Primer | |||
! scope="col" | Sequence | |||
! scope="col" | Tm(°C) | |||
|- | |||
|P1 forward | |||
|17484 5' CCCGCAGGTCCAATGTTGAG 3' 17503 | |||
|59 | |||
|- | |||
|P2 reverse | |||
|18268 5' ATCTGACAGAGAAGTGACCACG 3' 18247 | |||
|58 | |||
|} | |||
Primers for G to A SNP: | |||
{|border="1" cellpadding="5" | {|border="1" cellpadding="5" | ||
edits